GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:14:41, GGGenome : Alpaca genome, Vicugna_pacos-2.0.1/vicPac2 (Mar, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KB632439:14070665-14070679
TTAAGTGCTATTAAAGCATGTATGTCTTAG14070665TTCATTGACAACATTGTTTTTTCTTCTTCCTAACTGGTATAAAAT
KB632466:6964034-6964048
GACAGTTTGCAGTTCTTAGTTGTTAACTGA6964034TTCATTGACAACATTTGCAGCTTAAGATCTCCAGGTGATTCAGCT
KB632536:4284494-4284508
CTAGAATATATTATCACTTAGACACAGATT4284494TTCATTGACAACATTCTGTGGGCATCCACTTAATATTAAGCCAAG
KB632549:1682154-1682168
ATTGACCCTTTTTTATGTTGTAATAACTCT1682154TTCATTGACAACATTCCTTTCTCTGAAGTCTCTGTCTGAAATTAA
KB632595:2104572-2104586
GAAACAAAGGTTAGAGTTTAAGGAAACTAT2104572TTCATTGACAACATTAAATATTTACAAAATTTCAACTTTATCTCA
KB632601:3970798-3970812
GCCAACTGTGAGGTTTTCTCAGGCTAGTTG3970798TTCATTGACAACATTGGATTCCAAATGTCTCTCTTATGGCCAAAC
KB633254:27202-27216
AAGAAAAGAGTCAAGATTTTACTTACAATA27202TTCATTGACAACATTTCCTTCCATAATAAGACTACATAAAACCAA
ABRR02178701:967-981
CGTGATAAGGAGGGACAAGATGTGCTTCTG967TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCAGAAGTG
KB632435:6904866-6904880
GCCTGTTTTTCATATGCATATGTAATAGTG6904866AATGTTGTCAATGAAAACACAATAGAATTTGGAGTGCAGCATACT
KB632448:760527-760541
ACACCATGTTTTATTCACCACTAAGAAAAA760527AATGTTGTCAATGAAACTAGGATATGCCACTGTTTTTTAAGGCAT
KB632511:2830884-2830898
GAACAGTGGAAACGAGCTATGGATTATTTA2830884AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
KB632675:2251469-2251483
ATCCTGTGTCTGTCAGAGTCATTTCAATGC2251469AATGTTGTCAATGAAACAGAAAGCCTCACCTTTGTGTCCTAAAAG
KB632825:105259-105273
GAAAATCAGGTGAACAGATATTATTATTCT105259AATGTTGTCAATGAAGAAAGCAGGAAGCTAGTAACTGGTGGAGCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/vicPac2/TTCATTGACAACATT
lang : en | db : vicPac2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.78:28021/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.78:28021/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).