GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-18 13:56:36, GGGenome : African clawed frog genome, Xenopus_laevis_v2/xenLae2 (Aug, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr3L:3928055-3928069
AGAATCCAGGTTTCATAGCAATTTAACGCT3928055TTCATTGACAACATTCTTTGCTAATCACGTGTAAATTTAATTACA
chr3S:32667490-32667504
ATTCTCTTTTTCAAAATCTTCAAAGAGAGA32667490TTCATTGACAACATTTATAAGCCACATATAATACTCTTGGTGAGA
chr3S:40502524-40502538
CATTTAGCAGTCGATGTTTACTACAATCAG40502524TTCATTGACAACATTTCTATTTTTTATAAAGAAACCCCCCCCCAA
chr3S:77133123-77133137
ACTATATTAGACAAACAAAATGCTACAGTT77133123TTCATTGACAACATTGCATATGTCCTCTGAGGCTTTAGTGTACTG
chr6L:12854303-12854317
CACCAGCCCCATCACAGGATAACGAACTTC12854303TTCATTGACAACATTCTACGGCCGGAGTTCGGGAGGAGGAAAGAA
chr8L:20126780-20126794
AGAGCAGAAGGTCTTGGTGGGAAAGCCAAG20126780TTCATTGACAACATTAGGTAAATCATGTTGGGGTAAACTGGAAAC
chr9_10L:110936433-110936447
GGTTGTAAACGAATTATTGTTTGAAGCAAA110936433TTCATTGACAACATTTTTCTCATGGGACACAGATTCAGAAACACT
chr9_10S:33695240-33695254
TCAATATGAAATTATAGAAAACAATTAGTC33695240TTCATTGACAACATTGACAACATTGACTTGTCATTCTGTTGCCTA
chr9_10S:40560528-40560542
CACTTATTGTCTGTTACACATCGGATATGC40560528TTCATTGACAACATTTGGAAATATAAGGCTTGTAATTCATTTTGT
chr2L:139863839-139863853
CACCTCTGATCCAGCCTGGGTAAACCTGAA139863839AATGTTGTCAATGAAAAGCAACACATCTTGTCCCTCTTGATCTCT
chr2S:121367745-121367759
CACCTCTGAACCAGCCTGGGTGAACCTGAA121367745AATGTTGTCAATGAAAAGCAACACATCTTGTCCCTCTTGATCTCT
chr3L:91846639-91846653
TACCCCAAATAGCTATAAACAAGCTTTGTC91846639AATGTTGTCAATGAAAAGCATTTAGCATAACCTACTGACGTGCTC
chr3S:62715797-62715811
AATTGGGCAGCAAACTGGAAAATGAGGTTC62715797AATGTTGTCAATGAATGCAAGGCAATGCACTTTTGTAGAAATAAT
chr5L:110577980-110577994
GTAAGTACCTGCATTCAACTCCTTCACACT110577980AATGTTGTCAATGAAAGAACTAGTGTAAACGAACAGGATGTTCTA
chr6S:43455273-43455287
AGAAATCATCCTGCCAAATATTTTAAAGAC43455273AATGTTGTCAATGAAAAGCCCAAGCTGCGGTGCGGGAAAGCGACC
chr6S:99937662-99937676
CTTTCATGGTAAAAGTATGGAGCAATATTC99937662AATGTTGTCAATGAAAGGTCAGGCCATTTGCATTCATTAGCAGCC
chr9_10L:24792782-24792796
AATAAGGATATGCGAATGGAAATGGTGCAA24792782AATGTTGTCAATGAACTCTTTAACCTATTGTTCAAAAAATAGGCA
chr9_10L:108178719-108178733
ATGTACACACAAAGGCAACAAAGGCAATTG108178719AATGTTGTCAATGAAAGCAAAAGCGGTCTTAGCTGCCCGCAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/xenLae2/TTCATTGACAACATT
lang : en | db : xenLae2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.083 | 0.075 | search_plus_done; http://172.18.8.76:28750/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.005 | search_minus_done; http://172.18.8.76:28750/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.090 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).