GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 09:32:59, GGGenome : Xenopus tropicalis genome, JGI 4.2/xenTro3 (Nov, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL172726:2552644-2552658
ATAGGGTTCAGTTATGACTGCAACTGTGCG2552644TTCATTGACAACATTTATCCAGGTTTCTTCTGTGCAAATCGCTCC
GL172675:2760925-2760939
CTTCACATTATTTTATAAACTTCTCAATAC2760925AATGTTGTCAATGAATGTGGTATTTTCACATTTTCAGATGCCCGT
GL172706:1944947-1944961
CCAATAGCTTTGGGAATGAGCAGTGTAAGC1944947AATGTTGTCAATGAAACAAAATTATACAGGCCAATAACTTATTAT
GL173149:442457-442471
TTGTTCATCGGTACCGGACCATATAAGAAT442457AATGTTGTCAATGAAGCAACCAAAATATTGAATATTGTGAGAGTG
GL173305:394621-394635
TCTGCCTCCAAACCCCATTTATTTCAAGGT394621AATGTTGTCAATGAACTGGAATACCAGTTCCACACACCACTCCCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/xenTro3/TTCATTGACAACATT
lang : en | db : xenTro3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.082 | 0.073 | search_plus_done; http://172.18.8.76:28085/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.006 | search_minus_done; http://172.18.8.76:28085/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.089 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).