GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:06:30, GGGenome : Mimulus guttatus genome, v2.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_5:16352951-16352965
TTCGGATTCTTCTGTTGAATCATATTGTGT16352951TTCATTGACAACATTACGCTTGTTTTTGTTATTTTTAGTAGTCAA
scaffold_10:12703410-12703424
AACTTTTTGAACATTGTAGGTTTTATGATC12703410TTCATTGACAACATTATCACCCTTGATAGCAATTTTGAATAACAT
scaffold_416:14638-14652
AACTTTTTGAACATTATACGTTTTATGATC14638TTCATTGACAACATTATCAGCCTTGATAGCAATTTTGAATAACAT
scaffold_4:8570864-8570878
TTGATACTAAAAGTAACAAAAAACAACTAT8570864AATGTTGTCAATGAAACCCAACACAAGTCAACAAAAAAAAATCCA
scaffold_4:13716651-13716665
TTGACAATTAAATATAACAAAAACAACCGC13716651AATGTTGTCAATGAAACTCAACACGATTCAACAAAAAAGAATCCA
scaffold_11:11614173-11614187
AATGTTATTCAAATTGCTATCAAGGGTGAT11614173AATGTTGTCAATGAAGATCATAAAACGTACAATGTTCAAAAAGTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Mguttatus_v2.0/TTCATTGACAACATT
lang : en | db : Mguttatus_v2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.74:28307/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.74:28307/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.085 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).