GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-07-17 01:16:41, GGGenome : Microbat genome, Broad Institute Myoluc2.0/myoLuc2 (Jul, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL429767:63197321-63197335
ATCATAAGGGTGAAGTTGGCTAGCTGTGGC63197321TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
GL429772:9503777-9503791
TAAATATTCATCCATTCGCTTCTTTGTTTA9503777TTCATTGACAACATTTCGTGAGCATCTGCTATCGGCAGGCCCCGG
GL429826:5174857-5174871
CCAGAGCCCTTGCTCCTGTCCTGAATTAGG5174857TTCATTGACAACATTCTTCTCACCACATCCCTTTTCCCCAAACTT
GL429905:3170068-3170082
CTTTTGAAAAATCTCTAAAATGACATGTTA3170068TTCATTGACAACATTACTTGAAGGAAAAATAAATAGGAGGACATA
GL429905:3181773-3181787
CTTTTGATAAATATCAAAAATGACATGCTA3181773TTCATTGACAACATTACTTGAAGGAAAAATAAATAGGAGGACATA
GL430000:1294673-1294687
CTTTTCATTATTCTTGATGGCTATTTTATA1294673TTCATTGACAACATTTCAGAAATTACATATATTTTTAATTTTAAA
GL430034:1579932-1579946
GTTTTGTTTAGACATGTGTCATAGTTTTAT1579932TTCATTGACAACATTTTCTAAGACACCCAAACTCTGAACAGCATG
GL430294:478446-478460
AATTTTATCTTCAGTGTCGAACTTTTTAAC478446TTCATTGACAACATTCACCGTAATGTCAGATGTTTTCCCTTCAAC
GL430328:385455-385469
AATATTCATAGGGTTTTAAAAACATGTAAG385455TTCATTGACAACATTAACAGGGTGGGTTATTGCGCCGAAAGTCCA
GL430338:34263-34277
GAACAAACCAACTCAATAAACCAATGTTTA34263TTCATTGACAACATTCCAGTAACACGTGACACAGTAAAAAATGTT
GL432496:14019-14033
CTTTTCATTATTCTTGATGGCTATTTTATA14019TTCATTGACAACATTTCAGAAATTACATATATTTTTAATTTTAAA
AAPE02065229:4336-4350
TTAATGACAGGAAAGTAGCAAACCATGTTA4336TTCATTGACAACATTTTCAGCAAAATTTATAAAATGACATGAGCC
AAPE02069208:2682-2696
AATTTTATCTTCAGTGTTGAACTTTTTAAC2682TTCATTGACAACATTCACCGTAATGTCAGATGTTTTCCCTTCAAC
GL429782:11736752-11736766
CAGAAAATAGGGTAAGTTTCAGAAAGTAAA11736752AATGTTGTCAATGAAGGAGTACCTTCAGGATGACCCACTGGAGGG
GL429783:10430285-10430299
GCAAACTGCACCCCACCAAAAAAAAAAAAA10430285AATGTTGTCAATGAAGAATGTAATCACAAATAGTTTCATAGATAG
GL429801:5486580-5486594
TGAATGTTGAAATCACTATGATTTGGAAGA5486580AATGTTGTCAATGAAAAGGACAGCGAGTCAGAAGGTAAAATCTTT
GL429850:4205261-4205275
TCCTGTTTTTCATATGCATATGTAATAGTA4205261AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATACT
GL429916:379344-379358
GGCTCGTGTCATTTTATAAATTTTGCTGAA379344AATGTTGTCAATGAATAACATGGTTTGCTATTTTTCTGTCATTAA
GL429921:1914285-1914299
TTCCTGGACGGGAATCTTTCCAGGAGCGCG1914285AATGTTGTCAATGAAGCACATTGAGGTGCTCTGTGTGTATGTGCA
GL430258:345053-345067
CCAGGAATATGGATGTGATACCAAGATTTG345053AATGTTGTCAATGAATGTAGTTAAGATACACAACTGGAACTTTCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/myoLuc2/TTCATTGACAACATT
lang : en | db : myoLuc2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.073 | search_plus_done; http://172.18.8.78:28043/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.007 | search_minus_done; http://172.18.8.78:28043/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=37
0.087 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).