GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-07 17:47:40, GGGenome : Brassica oleracea genome, v2.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

C2 dna:chromosome chromosome:v2.1:C2:1:52886895:1
position: 1833539-1833553
CGTGATGCCGAGGGCCAAGATGTGTTGCTT1833539TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTATGTTGTT
C9 dna:chromosome chromosome:v2.1:C9:1:54679868:1
position: 51450097-51450111
CGTGATGCTGAAGGCCAAGATGTGTTGCTT51450097TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTTCTATGTT
C9 dna:chromosome chromosome:v2.1:C9:1:54679868:1
position: 51455784-51455798
CGTGATGCTGAAGGCCAAGATGTGTTGCTT51455784TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTTCTATGTT
Scaffold32992 dna:scaffold scaffold:v2.1:Scaffold32992:1:204:1
position: 11-25
TGTGTTGCTT11TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTATGTTGTT
Scaffold02081 dna:scaffold scaffold:v2.1:Scaffold02081:1:2784:1
position: 409-423
ATAACTACTTAAAAGTAAAAAATCATATCG409TTCATTGACAACATTTGGGTTGAAAAACTTATTTATAAATGCCAA
C2 dna:chromosome chromosome:v2.1:C2:1:52886895:1
position: 1827072-1827086
AACAACATAGCTCACCTGAGTGAAACGGAA1827072AATGTTGTCAATGAAAAGCAACACATCTTGGCCCTCGGCATCACG
C2 dna:chromosome chromosome:v2.1:C2:1:52886895:1
position: 19256547-19256561
ATTGGTGACTACTTGCGCATGGACGTGATG19256547AATGTTGTCAATGAAATCATCAGCTACACCATGAAGACGTGTACG
C5 dna:chromosome chromosome:v2.1:C5:1:46902585:1
position: 8963474-8963488
AGTAAATTTATAATTCATATGTCGTATGTA8963474AATGTTGTCAATGAAAACATACAAACCTGGAGTAAATTGTAATTT
C9 dna:chromosome chromosome:v2.1:C9:1:54679868:1
position: 51446567-51446581
AAGAACAGAGCTCACCTGAGTGAAACGGAA51446567AATGTTGTCAATGAAAAGCAACACATCTTGGCCTTCGGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Braol_v2.1/TTCATTGACAACATT
lang : en | db : Braol_v2.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.122 | 0.115 | search_plus_done; http://172.18.8.75:28171/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.129 | 0.007 | search_minus_done; http://172.18.8.75:28171/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.131 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).