GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:11:44, GGGenome : Cucumis melo genome, v3.6.1 (Jul, 2017)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr00
position: 18029381-18029395
AAGGATTTTTTAGACACGTTCGTCATAGTT18029381TTCATTGACAACATTTTGATTTACTTTTGTTTGCTTTGTTTGCAA
chr01
position: 888632-888646
TTTTTTTTCCCTTTAATGAATAATTAAACT888632TTCATTGACAACATTTGGGAGTAAAAACCTCTTTCTATTCAATAA
chr03
position: 12295784-12295798
AATTCTTCCGCTGTAAAGAGTTTTCATCCC12295784TTCATTGACAACATTATGTTTGGTGGAATGTCTCAGGAGATGATT
chr09
position: 20530735-20530749
TTTTGGCATATTTACCTGGGTAAAGCGGAA20530735AATGTTGTCAATGAAGAGAAGCACATCCTGTCCTTCAGCATCACG
chr11
position: 5571537-5571551
ATGCTCAGCCTCAATTTTGGAGTAAATCAA5571537AATGTTGTCAATGAAAACTATGACGAACGAGTCTAGGAAGTCCTT
chr12
position: 15352520-15352534
TCCAAGATTGTAGAAATGATAGAAAGAAAT15352520AATGTTGTCAATGAATTTCGAACTTTTGTGGTTTGATGATGATGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/CM3.6.1/TTCATTGACAACATT
lang : en | db : CM3.6.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.72:28210/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.72:28210/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).