GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 13:17:53, GGGenome : Cross-reactivity check for COVID-19 diagnostic primers (7 CoV + 32 organisms in WHO EUL), NIHS 2020/5/1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NZ_LNXT01000014.1 Legionella birminghamensis strain CDC#1407-AL-14 Lbir_ctg015, whole genome shotgun sequence
position: 21349-21363
AATAATCTGCTCGTCACGTTGGTCGACATC21349AATGTTGTCAATGAAAGACTTATCGATTTTTAAGCGGTCAATTTT
NC_003997.3 Bacillus anthracis str. Ames, complete sequence
position: 1526492-1526506
GCTATCTTCAATGAATATTGTCCCTTCTGG1526492AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
NZ_CP009913.1 Streptococcus salivarius strain NCTC 8618 chromosome, complete genome
position: 336794-336808
AATTTGTGTTTTCATATAAAATCCTTTCAG336794AATGTTGTCAATGAATAAAATTGTTTAGCCAACTGAAATATCAGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/COVID19-primercheck-EUL-20200501/TTCATTGACAACATT
lang : en | db : COVID19-primercheck-EUL-20200501 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.088 | 0.080 | search_plus_done; http://172.18.8.76:28831/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.010 | search_minus_done; http://172.18.8.76:28831/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.099 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).