GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-23 04:15:28, GGGenome : Ciona savignyi genome, CSAV 2.0 (Oct, 2005)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

reftig_0 dna:reftig reftig:CSAV2.0:reftig_0:1:3283047:1 REF
position: 2804437-2804451
ATTTGATTAGACATATGTAGTACTACAAAA2804437TTCATTGACAACATTGTACACAGTAATAAAATAAGATGTGCTAAT
reftig_156 dna:reftig reftig:CSAV2.0:reftig_156:1:1182915:1 REF
position: 659485-659499
TTGTCAAAAAAATGTGATTTTGAGTTCCCA659485TTCATTGACAACATTCTGCGAGACCATCTTCGTTTATAGAAACAG
reftig_73 dna:reftig reftig:CSAV2.0:reftig_73:1:496566:1 REF
position: 288554-288568
CCCATACGACATCGAACCACGCCGGTAAAG288554TTCATTGACAACATTGATTCTTCGGAGAGCGACACAACGACATCA
reftig_695 dna:reftig reftig:CSAV2.0:reftig_695:1:368346:1 REF
position: 298514-298528
CGAGTAAAGTGTATTTAATTATTCGTGTGT298514TTCATTGACAACATTTTGACAATAAATTAAACAAGGTTCAAACTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/CSAV2.0/TTCATTGACAACATT
lang : en | db : CSAV2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.082 | 0.073 | search_plus_done; http://172.18.8.76:28119/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.006 | search_minus_done; http://172.18.8.76:28119/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.088 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).