GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 09:00:14, GGGenome : Capsella rubella genome, v1.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_6:2823236-2823250
CGTGATGCGGAAGGCCAAGATGTCTTGCTT2823236TTCATTGACAACATTTTCCGATTTACTCAGGTGAGCCTTGTTCGC
scaffold_7:958387-958401
CGTGATGCTGAAGGCCAAGATGTCTTGCTT958387TTCATTGACAACATTTTCCGTTTCACTCAGGTTAGCCTTGTTCGT
scaffold_6:2819239-2819253
ACGAACAAGGCTCACCTGAGTGAAACGGAA2819239AATGTTGTCAATGAAAAGCAAGACATCTTGGCCTTCGGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Crubella_v1/TTCATTGACAACATT
lang : en | db : Crubella_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.083 | 0.074 | search_plus_done; http://172.18.8.74:28292/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.089 | 0.006 | search_minus_done; http://172.18.8.74:28292/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.089 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).