GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-17 00:36:01, GGGenome : Gossypium raimondii genome, v2.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr01:16052103-16052117
GGTTAACCGTGCACCTATATCCATATATCG16052103TTCATTGACAACATTCTAGTGAAAACGGATTATTATTTGAATTGT
Chr02:45765368-45765382
CAACCGTATTTGGATCAGTTTGTTGTAGTT45765368TTCATTGACAACATTCTGATTTATTCCAAGACTGAGTCTGAGCAT
Chr07:12662396-12662410
TCCATTCTCAACTGTTGTGGCATTTCCTGC12662396TTCATTGACAACATTTCCATTTAAATAACTGTAACCAGCAGCCTT
Chr07:40785767-40785781
CAACCCTATTTAGATCAATTTGTGGTAGTT40785767TTCATTGACAACATTTTGATCTATTCAAAATCTGAAGGAGCACGA
Chr09:43706194-43706208
TAGCCCTATCTGGATCAATTTGTGGAAGTT43706194TTCATTGACAACATTTTGATTTATTCGAAATCTTAAATTGAGCAT
Chr10:59166676-59166690
ACATACATATTTTATGAGAGGATGTAGTAA59166676TTCATTGACAACATTGGTGAAGGGCAAACACTTTTCACTATCTAA
Chr11:13247116-13247130
CCTTTTAAATTATCATTAATATGTTCTAAT13247116TTCATTGACAACATTTTAAATTTTCATTATATGGAATTATTTTAA
Chr12:28581665-28581679
CGTGATGCAGAAGGGCAGGATGTGCTTCTC28581665TTCATTGACAACATTTTCCGTTTTACTCAAGTAAGATGGTGTATT
Chr13:10913304-10913318
CAACTGTATTTGGATCAATTTGTGGTAGTT10913304TTCATTGACAACATTTTGATCTACATGAAATCTGAGTCCGAGCAT
Chr02:12927902-12927916
ATGCTCCGTCTCATCACGAGAATAGATTAG12927902AATGTTGTCAATGAACACAACAACGGATCTGTCTAAATACGATCT
Chr02:16235623-16235637
TTGGAAATAGAAGCTTTCAACTTCTTGTGA16235623AATGTTGTCAATGAAGTCCGGACCTATTGGTTTGGTCATTTTCTC
Chr04:22432477-22432491
GTGCTCACTCTCAGTTTTAGAATAAATCAG22432477AATGTTGTCAATGAAGACTACGACAAATTGCTCTAGATAAGGCTA
Chr04:26338573-26338587
ATGCTCAGACTCATCTCGTGAATAAATCAG26338573AATGTTGTCAATGAATACAACAACGAATCTGTCTAAATACAGTTT
Chr05:21533809-21533823
ATAATCTTCCTCAGTCTTAGAGTATACCAG21533809AATGTTGTCAATGAAGACCACAACGAATTGATTCAAAAATAACTA
Chr05:32403257-32403271
ATGCTCTGTCTTATCTCGTGAATAAATCAG32403257AATGTTGTCAATGAAGGCCACAACAAATCTGTCTAAATACGCCAT
Chr07:43344376-43344390
ATGATCACCTTCGGTCTTAAAGTATACCAC43344376AATGTTGTCAATGAAAACCATCACGAACTAATCCAAGTACAGTTG
Chr07:52563110-52563124
TCAAAACAAGCCTTGAAGCAGAATAATTGT52563110AATGTTGTCAATGAAGGGAAAAGCCCAATTAAAGGTGCCACTGAA
Chr08:12551559-12551573
GTGCTCCGTTTCAAATTTCGAATAGATCAA12551559AATGTTGTCAATGAAAACTACCACAAATTGATCTAAATAGGGTTG
Chr08:15889360-15889374
ATGCTCCATCTTATCACGAGAATAGATCAG15889360AATGTTGTCAATGAATACAACTGTCTAAATATGGTCTAAGAAAAC
Chr09:4225973-4225987
ATGATACTTCCATTATTTGGTACCAACTAC4225973AATGTTGTCAATGAATTGCTTGAGTTGGTGCCTTATCCACCTCTT
Chr10:31094203-31094217
ATGCACAGGCTCGTCTCATGAATATATCAG31094203AATGTTGTCAATGAAAACCACAACGAATCTGCCTAAGTACAATCT
Chr10:31407599-31407613
TTATAGACTAAAATGTTAGAAGAATCAAAA31407599AATGTTGTCAATGAAGAGGTATAGAGTAAAGCTCCCTCTATTGGG
Chr11:3158575-3158589
AAGGATACCATATCTATTTCTGAAGTAGAG3158575AATGTTGTCAATGAAGGAGCTGATGGCCATTACTCAAGGGCAGAG
Chr12:6840769-6840783
TTAAAATAATTCCATATAATGAAAATTTAA6840769AATGTTGTCAATGAAATTAGAACATATTAATGATAATTTAAAAGG
Chr12:28596081-28596095
AATACACCATCTTACTTGAGTAAAACGGAA28596081AATGTTGTCAATGAAGAGAAGCACATCCTGCCCTTCAGCATCACG
Chr13:20990509-20990523
ATGTTCCTCCTTAGACTTGGAATAGATCAA20990509AATGTTGTCAATGAAGACGACAACAAACTAGTCAAGGTAGGGCTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Graimondii_v2.0/TTCATTGACAACATT
lang : en | db : Graimondii_v2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.74:28301/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.008 | search_minus_done; http://172.18.8.74:28301/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.096 | 0.008 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).