GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-03 01:47:02, GGGenome : Leersia perrieri genome, Lperr_V1.4 (Mar, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

5 dna:chromosome chromosome:Lperr_V1.4:5:1:20807039:1
position: 5923116-5923130
TATGATTGAGCACTCCTACCTACTTTGCAA5923116AATGTTGTCAATGAACTGTTTGTTCGCTGCATAAATGTTCAATGA
5 dna:chromosome chromosome:Lperr_V1.4:5:1:20807039:1
position: 18768258-18768272
TCCTTCATAAATTACCTGAGTGAAACGGAA18768258AATGTTGTCAATGAACAGAAGCACATCTTGTCCTTCAGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Lperr_V1.4/TTCATTGACAACATT
lang : en | db : Lperr_V1.4 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.099 | 0.092 | search_plus_done; http://172.18.8.75:28178/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.004 | search_minus_done; http://172.18.8.75:28178/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.104 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).