GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:44:51, GGGenome : Manihot esculenta genome, v6.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chromosome10:23532639-23532653
CAATGTTTCTCTTTCTGTTCGAGAAGATTA23532639TTCATTGACAACATTCCATAAGTAGAAAGAAAATGTCAAACTCTT
Chromosome12:27849680-27849694
ATAGAAAATTGTTGTATGTATGTTGTGTGA27849680AATGTTGTCAATGAATAAGGAAGCAAAGAAATTAAATAAAGTAAA
Chromosome16:5868373-5868387
TTCTATATTTAGTAGGTTTTTCACTTTAAT5868373AATGTTGTCAATGAACAATTTCTTTTTGTGTTTTTTTTTTTTTAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Mesculenta_v6/TTCATTGACAACATT
lang : en | db : Mesculenta_v6 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.090 | 0.083 | search_plus_done; http://172.18.8.74:28304/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.098 | 0.008 | search_minus_done; http://172.18.8.74:28304/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.099 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).