GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:42:55, GGGenome : Aardvark genome, OryAfe1.0 (May, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold:OryAfe1:JH863720.1:1:38460149:1 scaffold JH863720.1
position: 6610289-6610303
TGCTTCTGGCAGTGCATGGTATATTCAGTG6610289TTCATTGACAACATTACAATTCAAAGGCATCAAATCCTCTTCGGT
scaffold:OryAfe1:JH863719.1:1:40202977:1 scaffold JH863719.1
position: 5372705-5372719
CCTCAGGAAGCCCATATTTCCCAGATCCTG5372705TTCATTGACAACATTTCCAGGATGAGCACCATAGCAATCAGGATG
scaffold:OryAfe1:JH863768.1:1:15573907:1 scaffold JH863768.1
position: 9149412-9149426
CATCTATCCACCTGTACACCCATGTTTGTC9149412TTCATTGACAACATTGTACTATATGTGCAAAGGGGTTCATCTTTG
scaffold:OryAfe1:JH863791.1:1:12356756:1 scaffold JH863791.1
position: 5546777-5546791
CTTCATCACTTCTAGCTCTAACCATTTACT5546777TTCATTGACAACATTACCTACACATGTTGGTACATCATTTTCTAT
scaffold:OryAfe1:JH863791.1:1:12356756:1 scaffold JH863791.1
position: 9657710-9657724
TTCTTCCTTGTAAGAATTTGAGTATTATCT9657710TTCATTGACAACATTGTAATTCAGGATAGATCTTAAAATATTATT
scaffold:OryAfe1:JH863859.1:1:8596878:1 scaffold JH863859.1
position: 519918-519932
AATATCCCAAATAATACTATACCTTTCTAT519918TTCATTGACAACATTATGCTAACTAGACTTCATGAGCAGACAATA
scaffold:OryAfe1:JH863928.1:1:6374974:1 scaffold JH863928.1
position: 3705413-3705427
GTTGACACTCTTTAAACAGTGACTAAAAGA3705413TTCATTGACAACATTGTTCTATTAAACAGGTCAGAATTGCTTCCT
scaffold:OryAfe1:JH864023.1:1:4337110:1 scaffold JH864023.1
position: 1031271-1031285
CTTTGCCTTGTAGGCATATGATTATTTCTT1031271TTCATTGACAACATTGTATTATAGGATAGATCTTGAAACATTCTT
scaffold:OryAfe1:JH864033.1:1:4286233:1 scaffold JH864033.1
position: 3184595-3184609
TCTTCCTTGTAGGCATATAGATATTATGCT3184595TTCATTGACAACATTGTATGTAAGGATAGATCTTGAAATATTCTT
scaffold:OryAfe1:JH864065.1:1:3625835:1 scaffold JH864065.1
position: 675769-675783
AAAGCATAGAAAATTAAAGTACTAAACTTG675769TTCATTGACAACATTTTTAATTTTTTTGTCCTCTGTACTTCAAAC
scaffold:OryAfe1:JH864144.1:1:2702783:1 scaffold JH864144.1
position: 167337-167351
CACGTGACTGCTATTGACACCATGCAGGAT167337TTCATTGACAACATTTACTTCTGATGACAGAGGTTTATTCATGAG
scaffold:OryAfe1:JH864175.1:1:2487417:1 scaffold JH864175.1
position: 835684-835698
TTGGACTGCAGATTCAGAGGCAATGACTGT835684TTCATTGACAACATTTCATAAACCCTTGATTTTAATGCCCTTTGT
scaffold:OryAfe1:JH864438.1:1:1063986:1 scaffold JH864438.1
position: 564515-564529
TCTTCCTAGTAGGCATATGCATATTATCCT564515TTCATTGACAACATTGTACGTTGTATTTCTATATAATAGGAATAT
scaffold:OryAfe1:JH863747.1:1:19260028:1 scaffold JH863747.1
position: 4771731-4771745
CAATGTGGTTAATTACATTCATTGGTTTTA4771731AATGTTGTCAATGAAGCAAAGAGAATACTGAAAAGGAGATCAGAA
scaffold:OryAfe1:JH863759.1:1:16595691:1 scaffold JH863759.1
position: 6888877-6888891
GCCTGTTTTTCATATGCATATGTAATAGTG6888877AATGTTGTCAATGAAAATACAATAGTATTTGGAGCGCAGCATACT
scaffold:OryAfe1:JH863777.1:1:13420349:1 scaffold JH863777.1
position: 12421864-12421878
AAAAGAAAAACTATAAGCTTATACAGTCAA12421864AATGTTGTCAATGAATATTTTTATCCATCTTATTAGCCTTAGCCT
scaffold:OryAfe1:JH863809.1:1:11063368:1 scaffold JH863809.1
position: 4787753-4787767
GAACAATGGAAACGAGCTATGGATTATTTA4787753AATGTTGTCAATGAACTCAACTACATGACTCAAATTGTTATCATG
scaffold:OryAfe1:JH863809.1:1:11063368:1 scaffold JH863809.1
position: 10073530-10073544
TGTCTTCTCAATAGCATCACATGCACTAGA10073530AATGTTGTCAATGAATAAGAAAGACCACAGAAGAACTGATGTGTT
scaffold:OryAfe1:JH863816.1:1:10536798:1 scaffold JH863816.1
position: 3937241-3937255
GCACCAGACTAAGCTCCTAAGTTCTATTTG3937241AATGTTGTCAATGAAAGACAAGCAAGTGAAGTAAATGAAGAGAAA
scaffold:OryAfe1:JH863820.1:1:10350141:1 scaffold JH863820.1
position: 6439904-6439918
AGTGCAAATTACATTTTATTTTACTTCAGT6439904AATGTTGTCAATGAAAAGCGAAAATATTGCAGATTATATCAAAGG
scaffold:OryAfe1:JH863832.1:1:9740889:1 scaffold JH863832.1
position: 6756971-6756985
AATTTTTCTGTGCTAAGGTAATATAACGAA6756971AATGTTGTCAATGAAAATTTAATGCTTTGTTGTGTGAACAACAAA
scaffold:OryAfe1:JH863965.1:1:5224222:1 scaffold JH863965.1
position: 1970149-1970163
AACAACATTTTAAGATCTATCCTGAAGTAC1970149AATGTTGTCAATGAAAGGAAAATATCCATATGCCTATAAGGAAGA
scaffold:OryAfe1:JH864026.1:1:4330867:1 scaffold JH864026.1
position: 724347-724361
AAGAAGGACAGCAGTTGTGGACTGGGGTGG724347AATGTTGTCAATGAAAATCCAGTCTCCTAAATGGTAGGATTTTGT
scaffold:OryAfe1:JH864417.1:1:1096918:1 scaffold JH864417.1
position: 599787-599801
TGGATATGTATAAGAAAATTCCCAATTTTA599787AATGTTGTCAATGAATTCAAAATATTTCAAAACACTGTGTAGAAC
scaffold:OryAfe1:JH864573.1:1:750449:1 scaffold JH864573.1
position: 129193-129207
AAGAATGTTTCAAGATCTATCCTGAAGTAC129193AATGTTGTCAATGAAAGAATAATAGCCATACTTCTCTAAGGAATA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/OryAfe1.0/TTCATTGACAACATT
lang : en | db : OryAfe1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.088 | 0.081 | search_plus_done; http://172.18.8.76:28117/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.106 | 0.018 | search_minus_done; http://172.18.8.76:28117/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=37
0.112 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).