GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:31:38, GGGenome : Amazon molly genome, Poecilia_formosa-5.1.2 (Oct, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KI519901.1 dna:scaffold scaffold:PoeFor_5.1.2:KI519901.1:1:796020:1 REF
position: 467975-467989
ATATAGCATAACATAAAACCAAGATTTTAT467975TTCATTGACAACATTTCCTGGATGTTTTCTTTTTTTTTTAAATCA
KI519617.1 dna:scaffold scaffold:PoeFor_5.1.2:KI519617.1:1:5572511:1 REF
position: 4799141-4799155
TACCAACCTGAGCTTCTTAACTGTGATGTA4799141AATGTTGTCAATGAACAGGACATATTAGCTGTGGTTGTCAGAAAA
KI519705.1 dna:scaffold scaffold:PoeFor_5.1.2:KI519705.1:1:2098595:1 REF
position: 1126569-1126583
TATTAGATCCTGCAGCTACTCAGCAAACAT1126569AATGTTGTCAATGAATGTAGAAATCTGCATGGCAGTGCAGTTGGT
KI519984.1 dna:scaffold scaffold:PoeFor_5.1.2:KI519984.1:1:605445:1 REF
position: 181323-181337
TTCCTTCTTGCATCCGAAATCCGGCCTCAA181323AATGTTGTCAATGAAGAAGTTTGTTGTTCTGTTGGTCTGTGGGCC
KI519987.1 dna:scaffold scaffold:PoeFor_5.1.2:KI519987.1:1:532583:1 REF
position: 143237-143251
AAATAAAGCGATTCTGGGAAGCCTCTCGTC143237AATGTTGTCAATGAACACATTGAAGACCTGCAGGTTTGGGTTACA
KI520061.1 dna:scaffold scaffold:PoeFor_5.1.2:KI520061.1:1:417825:1 REF
position: 113216-113230
TTTTAGTTACAGATGAGTCGTCTATTTGAT113216AATGTTGTCAATGAAGGCTAGCGGTAATCGCTGTTGATAGGAACA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/PoeFor_5.1.2/TTCATTGACAACATT
lang : en | db : PoeFor_5.1.2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.077 | search_plus_done; http://172.18.8.76:28118/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.096 | 0.011 | search_minus_done; http://172.18.8.76:28118/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.098 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).