GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:08:23, GGGenome : Prunus persica genome, Prupe1_0 (Mar, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_3 dna:supercontig supercontig:GCA_000346465.1:scaffold_3:1:22025550:1
position: 5632810-5632824
TATGTAATCAATAATGCTATTTGTCATATA5632810TTCATTGACAACATTGTTATTTTGTATTATATTTACCGACCACAT
scaffold_3 dna:supercontig supercontig:GCA_000346465.1:scaffold_3:1:22025550:1
position: 14568021-14568035
AGGTTTTGATGCCAAGCCACATGTGAGGCT14568021TTCATTGACAACATTTTCTTGCATTAAAAAATTCTAAGGGTACAA
scaffold_7 dna:supercontig supercontig:GCA_000346465.1:scaffold_7:1:22790193:1
position: 1880982-1880996
GAAGTTTCTCTCTGTTCGGTTTAATTATTT1880982TTCATTGACAACATTGGATCATGGTTAGACTTTCAAGATAAACAG
scaffold_7 dna:supercontig supercontig:GCA_000346465.1:scaffold_7:1:22790193:1
position: 14646814-14646828
AACAAACAATTTTAGTAAGTGAAATCTTAA14646814TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTTCAG
scaffold_4 dna:supercontig supercontig:GCA_000346465.1:scaffold_4:1:30528727:1
position: 4305224-4305238
AATATAGTAGATGAAGGTTGAATCTGGATT4305224TTCATTGACAACATTCAAAAAGGGGTGTATTTGAATGAAAAAGTT
scaffold_2 dna:supercontig supercontig:GCA_000346465.1:scaffold_2:1:26807724:1
position: 12170683-12170697
TTGTTTCTCTTGAAATTCTAACCATGATCC12170683AATGTTGTCAATGAAAAACAATTAAACCGAACAGAGGGAAACTTC
scaffold_4 dna:supercontig supercontig:GCA_000346465.1:scaffold_4:1:30528727:1
position: 5448151-5448165
CTGTTTATCTTGAAATTCTAACCATGATCC5448151AATGTTGTCAATGAAAAACAATTAAACCGAACAGAGGAAAACTTC
scaffold_4 dna:supercontig supercontig:GCA_000346465.1:scaffold_4:1:30528727:1
position: 12280128-12280142
TACATGCAAATATTCTTCCATACGCTTTTG12280128AATGTTGTCAATGAAATTTAGGAGGAGATGGTGAAGGAAGGAAGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Prupe1_0/TTCATTGACAACATT
lang : en | db : Prupe1_0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.75:28194/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.006 | search_minus_done; http://172.18.8.75:28194/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).