GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:23:48, GGGenome : Theobroma cacao genome, Theobroma_cacao_20110822 (May, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

9 dna:chromosome chromosome:GCA_000403535.1:9:1:42035188:1
position: 6168650-6168664
TCTGTCCATTCATATATAGGGAAAAGAAAA6168650TTCATTGACAACATTTTAATAACAAAAAAAAAACAAAAGTAAGAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Thecc_20110822/TTCATTGACAACATT
lang : en | db : Thecc_20110822 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.091 | 0.084 | search_plus_done; http://172.18.8.75:28201/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.098 | 0.008 | search_minus_done; http://172.18.8.75:28201/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.098 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).