GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-24 05:26:35, GGGenome : Xenopus tropicalis genome, XenBase/UCB 10.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr2:
157800311-157800325
AGGGAGTGGTGTGTGGAACTGGTATTCCAG157800311TTCATTGACAACATTACCTTGAAATAAATGGGGTTTGGAGGCAGA
Chr1:
44658551-44658565
GGAGCGATTTGCACAGAAGAAACCTGGATA44658551AATGTTGTCAATGAACGCACAGTTGCAGTCATAACTGAACCCTAT
Chr2:
67044379-67044393
TTGTTCATCGGTACCGGACCATATAAGAAT67044379AATGTTGTCAATGAAGCAACCAAAATATTGAATATTGTGAGAGTG
Chr4:
103557268-103557282
CCAATAGCTTTGGGAATGAGCAGTGTAAGC103557268AATGTTGTCAATGAAACAAAATTATACAGGCCAATAACTTATTAT
Chr7:
83646571-83646585
CTTCACATTATTTTATAAACTTCTCAATAC83646571AATGTTGTCAATGAATGTGGTATTTTCACATTTTCAGATGCCCGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Xentr10.0/TTCATTGACAACATT
lang : en | db : Xentr10.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.081 | 0.073 | search_plus_done; http://172.18.8.77:28889/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.006 | search_minus_done; http://172.18.8.77:28889/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).