GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-07 21:05:40, GGGenome : Marmoset genome, calJacRKC1912 (Dec, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2
position: 44989381-44989395
TTAAGTCTTCTTAATTTACATTGCTATTAT44989381TTCATTGACAACATTAATAACTGTGTAACAAACTATGCAAGTTTT
chr2
position: 184253246-184253260
GTGGTGCCTGGCCTGAGTCAGCACATTAGC184253246TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
chr4
position: 167363610-167363624
CTTTCAAATATTTTACAGAGTTTGACTCTT167363610TTCATTGACAACATTAACACCACCCAAAAGAGAAACGTGAGCCAA
chr5
position: 42098707-42098721
CATATCTCAAAATAAGAGCCATCCAATGGG42098707TTCATTGACAACATTATGCTGAATGGGTAAAAGCTGGAAGCATTT
chr6
position: 92566165-92566179
ATTGCAGCAAAGTAGCACATTTATATTCTA92566165TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr9
position: 41676410-41676424
TACATGAATCTACATGACTTTTCATTCTTT41676410TTCATTGACAACATTTCATGGAAAGAAATTCTACAGGAGAGGGTT
chr10
position: 51619658-51619672
CAGAAATTTTGGAAATGCTACTGTTGCTTT51619658TTCATTGACAACATTAGCTGGGACTGTATTAAATATCAAATATAT
chr19
position: 37649492-37649506
GCATACGGAGAAACTGGATAGCAAAATAAA37649492TTCATTGACAACATTTCCAACAAAACTAGGTGACAAACCATGAAT
chr1
position: 29627070-29627084
GTTGTCACCTCAGTGTGAGTTACCTCAGGC29627070AATGTTGTCAATGAATACAGCCTCCAGGGAGAAACTTCAGACTGC
chr3
position: 24928352-24928366
TGTAGTCAGCAAATAGTTAATTGCTGTTTA24928352AATGTTGTCAATGAAAAGGAGTATTACACAAAATCAGAGGATTTA
chr3
position: 80048043-80048057
ATATGAAAATTCAATAAAAGTACATTACAA80048043AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
chr4
position: 88414603-88414617
TTTAGGTTTTATGTAGTTTTCAGATTGTAT88414603AATGTTGTCAATGAATTCAAGTAAAAACAAACTTCAAATGAGACA
chr7
position: 104870853-104870867
AATGAGACTCGAGTTGGCATCTTCATGGGC104870853AATGTTGTCAATGAACTGTTTTCTCAGCAGCCTCCTGGTGAGTGA
chr10
position: 34724846-34724860
GAAAAAAAACCCAGAACTTTTAAAATGAAA34724846AATGTTGTCAATGAAACTAAAAATATCTTGGACAAGTTTAACATA
chr11
position: 38520572-38520586
CACACAAAGCCATGCTTCCTGAATCCATAA38520572AATGTTGTCAATGAAATGGTTAAAATTGTTGTATATATTGTGTCC
chr13
position: 13714366-13714380
TCTGAGACATGACACCTGGGTTTAGATCCT13714366AATGTTGTCAATGAACACAACTTCTTTGGTCATTCCCAATATATT
chrX
position: 107976730-107976744
TATGCCTTTCTCTTAATGTACAAGTAAATA107976730AATGTTGTCAATGAAATGGGAATTTTTATTGGGTTGGGGATTTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/calJacRKC1912_chrM_d3g2101/TTCATTGACAACATT
lang : en | db : calJacRKC1912_chrM_d3g2101 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.75:28815/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.089 | 0.009 | search_minus_done; http://172.18.8.75:28815/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.094 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).