GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-11-29 11:44:23, GGGenome : Chicken genome, ICGSC Gallus_gallus-4.0/galGal4 (Nov, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr3:92660230-92660244
TAGCAGACTTGTAACCTTTATGAATCTGTA92660230AATGTTGTCAATGAAATGGCTTCTAAAGATGATTAAACACCATAT
chr4:11202588-11202602
TTCAGGGTACAGCCACAGTCCCTGATGTTA11202588AATGTTGTCAATGAAATGTCATGAGTGCTGTTCTGCAATAAGGCT
chr2:3543467-3543481
ACTTCACACTCTACTTGCACAGAGTTAAAA3543467TTCATTGACAACATTGCTCTAAATCATCAGACAAGGATGTAATGG
chr14:14609061-14609075
AAGAGGGGGTGGTGAGAGAGGAAGCTGTGC14609061TTCATTGACAACATTCCTTGATGTTGTTGCCACTGGTAGAGTGGA
chr21:754139-754153
TGCAGCAAATATTTTAAAGAAAACATGAAA754139TTCATTGACAACATTAATCAACAAATATTATTCAACTTATATTGG
chrZ:49811250-49811264
CATGATAACAATCTGTGTCATGTAATTGAG49811250TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCATTGTTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/galGal4/AATGTTGTCAATGAA
lang : en | db : galGal4 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.069 | search_plus_done; http://172.18.8.76:28072/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.080 | 0.003 | search_minus_done; http://172.18.8.76:28072/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=48
0.081 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).