GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:31:32, GGGenome : Human pre-spliced RNA, RefSeq curated protein coding on hg38, D3G 19.06 (Jun, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NM_001304840.2|HECW2|chr2:196194369:196362222:-|prespliced
position: 149073-149087
TGACAGTATAGTTATATGAGAAGCAACTTC149073TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
NM_020760.3|HECW2|chr2:196194369:196592684:-|prespliced
position: 379535-379549
TGACAGTATAGTTATATGAGAAGCAACTTC379535TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
NM_001348768.1|HECW2|chr2:196194369:196593692:-|prespliced
position: 380543-380557
TGACAGTATAGTTATATGAGAAGCAACTTC380543TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
NM_014296.2|CAPN7|chr3:15206225:15252916:+|prespliced
position: 42058-42072
ATTGTAATAGCCAGAAATTGGAAACATATA42058TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
NM_152744.3|SDK1|chr7:3301447:4269000:+|prespliced
position: 222594-222608
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC222594TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
NM_012301.3|MAGI2|chr7:78017056:79453574:-|prespliced
position: 731473-731487
TATATTTGTTATAGAATATTATGTTAAATC731473TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
NM_001301128.1|MAGI2|chr7:78017056:79453574:-|prespliced
position: 731473-731487
TATATTTGTTATAGAATATTATGTTAAATC731473TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
NM_001135805.1|SYT1|chr12:78863992:79452008:+|prespliced
position: 243522-243536
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA243522AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_001291901.1|SYT1|chr12:78864668:79452008:+|prespliced
position: 242846-242860
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA242846AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_005639.2|SYT1|chr12:78864668:79452008:+|prespliced
position: 242846-242860
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA242846AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_001135806.1|SYT1|chr12:79045652:79452008:+|prespliced
position: 61862-61876
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA61862AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_016836.3|RBMS1|chr2:160272150:160493807:-|prespliced
position: 127190-127204
AAGTTCCAAAGTAAATTTGCATTATATGCT127190AATGTTGTCAATGAATAGAATATAAATGTGCTTCTTTGCTGCAAT
NM_002897.4|RBMS1|chr2:160272150:160493807:-|prespliced
position: 127190-127204
AAGTTCCAAAGTAAATTTGCATTATATGCT127190AATGTTGTCAATGAATAGAATATAAATGTGCTTCTTTGCTGCAAT
NM_001080448.2|EPHA6|chr3:96814580:97748942:+|prespliced
position: 545898-545912
AATTTGAATATTAATTTTAAAATTTATTCA545898AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
NM_001350622.1|KHDRBS2|chr6:61679959:62286227:-|prespliced
position: 287903-287917
AGAAATAGCAACTTATTATAGTATGAGTAA287903AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NM_152688.3|KHDRBS2|chr6:61679959:62286227:-|prespliced
position: 287903-287917
AGAAATAGCAACTTATTATAGTATGAGTAA287903AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NM_133468.4|BMPER|chr7:33904910:34155872:+|prespliced
position: 214039-214053
TCTACAGATTTTGGATTTACCAGCCCCCAC214039AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hg38_refSeqCuratedProtCoding_prespliced_d3g1906/TTCATTGACAACATT
lang : en | db : hg38_refSeqCuratedProtCoding_prespliced_d3g1906 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.75:28799/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.009 | search_minus_done; http://172.18.8.75:28799/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.094 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).