GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-07 20:26:50, GGGenome : Mouse genome, GRCm38/mm10 (Jan, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1
position: 32385455-32385469
TTTTTAAAGACAGCAGGAAATAGCAAATAA32385455AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC
chr2
position: 47333047-47333061
ATATCTATTTATTCATTGATGTAGCTTTCA47333047AATGTTGTCAATGAACACTGTTACTTCGTTGAGCACATGAAAAGT
chr3
position: 39320050-39320064
GTTGCCCCAGATTCAAGCTGCATGTTGACC39320050AATGTTGTCAATGAACTTCAACTACAAGTTCTGAGGCAGAATCTA
chr3
position: 42777516-42777530
TTAAACATCAGAGAAATGAAAAATAAGTAA42777516AATGTTGTCAATGAATAAACATCCCTGTAAGTTAAGGTTTGCAAT
chr5
position: 8380809-8380823
TAGCATCCATGCCCCCAAGCCAAAAGCATC8380809AATGTTGTCAATGAAACATTACTAAAGTTTAAAGTACATGTTGAC
chr2
position: 131480113-131480127
AGACAAATTAAGACTGTATTGTATCATGGT131480113TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
chr5
position: 42318229-42318243
TAGAATCAGTGTAAGCCATCCCTACACTTA42318229TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
chr6
position: 141421528-141421542
AAAGTACTATCAGTTTCCTAAATATATCCA141421528TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
chr6
position: 146175076-146175090
TGAACACATTCTCCCTGTTTGTGTCATCAC146175076TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
chr10
position: 47062898-47062912
TATTTCTTTCTGTTTGTTTATATGATGGAC47062898TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
chr14
position: 109241664-109241678
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109241664TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/mm10_d3g2101/AATGTTGTCAATGAA
lang : en | db : mm10_d3g2101 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.076 | 0.068 | search_plus_done; http://172.18.8.78:28019/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.006 | search_minus_done; http://172.18.8.78:28019/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=45
0.085 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).