GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-01-23 22:22:58, GGGenome : Nile tilapia genome, Broad oreNil1.1/oreNil2 (Jan, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chrLG1:23155138-23155152
TACTTACTTTTATCACCTGAGCATTGCTTG23155138AATGTTGTCAATGAATAATTGCTTCTAATCAGTTAAAGCAGCTCT
chrLG5:16877472-16877486
GTTGTCACATGAACTAAGGCTAACTTTCAC16877472AATGTTGTCAATGAAATGATCAAAGGTCACTCCAACATGGACTGT
chrLG12:20941738-20941752
CACACGGGTAGCATACAAGGTTTTTGTCTG20941738AATGTTGTCAATGAATCACTATTGGATCAGATTAGTGCATGCTTT
GL831294-1:1650426-1650440
TCTGGCCATTATGTGAAGTCAAAGACACTC1650426AATGTTGTCAATGAAGGACGCCTTTAAAAATCTTTAACACTATTA
chrLG1:14435814-14435828
GATATATTTAAATTCAGTTAATGAAAAATG14435814TTCATTGACAACATTTCCAAGCCCACAATATTTCTTCCTGCCTAC
chrLG5:12981992-12982006
AATTCTTTGTTGCCTTTCACTTCAGGAAGC12981992TTCATTGACAACATTAATAGTCTCTGGGATCTCCAACCAATGATT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/oreNil2/AATGTTGTCAATGAA
lang : en | db : oreNil2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.76:28080/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.081 | 0.004 | search_minus_done; http://172.18.8.76:28080/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=46
0.081 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).