GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:45:30, GGGenome : Tasmanian devil genome, WTSI Devil_ref v7.0/sarHar1 (Feb, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1_GL834636_random:38418-38432
AAGTTTGACTAGATGACTTCTGAGGTCCAT38418TTCATTGACAACATTCTATGTTCTATGTTCTTTCATTCTGAATTC
chr1_GL834763_random:705263-705277
TCTATCTAGTTTCTGGACTGCTTTTCAGTT705263TTCATTGACAACATTTTCTTTTCTTTTCTTCTTTTTTTTTCTGAG
chr1_GL835949_random:43560-43574
AAAATGTCAACAAACAAAAGCCATGTACTA43560TTCATTGACAACATTACAGTATAGACTTCCTTCTTTCTATATAGT
chr2_GL841299_random:2073583-2073597
GGAAAAACAAAGCAACTTTTCCTATGTCTC2073583TTCATTGACAACATTGTTTACTATTAAAGAATAAACAAGATCAGG
chr2_GL841300_random:1412916-1412930
ACATTGGCCTTCTTGTTACTCTTCATGTTT1412916TTCATTGACAACATTATATCTTCTGATTACCTGATCATATACCTG
chr2_GL841401_random:723978-723992
GTATTGTTATATAAAGTCTTCTTCTGTAGG723978TTCATTGACAACATTTTTGTAGCAAATCTAGCAGTAGAGAAAACA
chr3_GL849706_random:139476-139490
AATAAGTTATTCCTCTATTATTCACTAATC139476TTCATTGACAACATTAATTTATTTCTTATATTAATATTCACTGTG
chr3_GL850557_random:29032-29046
AGGGAATTTCAGAAAACCATTTCCTTTTGC29032TTCATTGACAACATTTAAGCCTTTGAGTATGGATCACAATAAATT
chr4_GL857006_random:1127546-1127560
TCCTCGGTGAAGTACGACTCAGAGAAGCAC1127546TTCATTGACAACATTTACATGCCGGTGGGGCTGGCGGTCTCCTCC
chr4_GL857016_random:476336-476350
ATGAGTCTGAGAGTCAGAGGGAGAAAGGCT476336TTCATTGACAACATTTATTCCTGGTATGACTTCAGGTGGGTCCCT
chr4_GL857151_random:25872-25886
GGTCTAAGCCCTGTTCTGAAGCAATAGTGA25872TTCATTGACAACATTTTCAAGGCAAGTAAGTATTGCAGGGAATTA
chr5_GL861687_random:977231-977245
AAGCTACAGGGAAATGAAGAAGGCTGAAGA977231TTCATTGACAACATTGGAAAGAGCAGTTTTAGTTGAATGTTAAGA
chr1_GL834618_random:3488170-3488184
ACACTACCAGGTTAGATGAATGGCAAGATA3488170AATGTTGTCAATGAAAAAAAAAAATTGTAACTTTGCCCAGAGTCA
chr1_GL834650_random:1269823-1269837
AGGGGGTAGAGCCAGTCCAAAAGACTACTG1269823AATGTTGTCAATGAATGAATGAATGAATGTATAGATGAATGAGTG
chr2_GL841150_random:93717-93731
GATCAGTGGAAGCGTGCTATGGATTATCTA93717AATGTTGTCAATGAACTCAATTACATGACTCAAATTGTTATCATG
chr2_GL841316_random:205344-205358
TTCCCAAAAGTTGTGTGGATAGATTTCAGG205344AATGTTGTCAATGAACTTAGATAGAAGAAAATATCTTGGAATTTC
chr2_GL841376_random:2827382-2827396
CAGTTCTGTGATTGTTATGAAGCTATTAGA2827382AATGTTGTCAATGAAATGTCAAATGCACCAGGAAATTATGTTCTC
chr2_GL841434_random:112092-112106
CATTCCAATATCATTGCCAAGAAAACTCCA112092AATGTTGTCAATGAAGAGTTGGACATGATTGAAAATGACCAAGAT
chr2_GL841498_random:852480-852494
CCTGTGCAAAAGCAATGAGATGGGAAAGAA852480AATGTTGTCAATGAAGAGTAATAAGTAGGTAAATTTGGATAGAAC
chr3_GL849653_random:294962-294976
TCTGTGTGCAATGGATTGCTTTGTAAGTCT294962AATGTTGTCAATGAACTATCAAAATCATGTTTTTAAGTTAATTAA
chr3_GL849656_random:592583-592597
ACAACACTGGTGAAAAGGAAGATTTTCACC592583AATGTTGTCAATGAAGTAAAGTAAATTAATCTTCCTTTATGGAAC
chr3_GL849686_random:264881-264895
AGAGAAAAATGATAGGAATAGCTTGGGAGA264881AATGTTGTCAATGAAAAAAGATTTTTATGTTTTTAAGATAGAAGA
chr3_GL849801_random:111799-111813
TTAAAGTTAACAAAAAGATGAAATATAGAC111799AATGTTGTCAATGAATGATTATAGCAAAAGCATACATTTTTTTTT
chr3_GL849876_random:1006502-1006516
TCACTTACATATAAGATTAGGGAAATTCCA1006502AATGTTGTCAATGAACTATCTTCTCAGGCTAAATACAAACATATC
chr4_GL857875_random:9332-9346
TTGCTAATTCCCTGCAATGCTTACCTTGAA9332AATGTTGTCAATGAATCACTATTGCTTCAGTACAGGGCTTAGACC
chr5_GL861556_random:561362-561376
ATCATTACATTCATCATTTGTTTGTTTTTA561362AATGTTGTCAATGAATAAATTGTTCTCCTGGTTTTGCTTACTTTA
chr5_GL861594_random:1012478-1012492
CAAGACTCTGTTTATTCAAATAACTAACAT1012478AATGTTGTCAATGAAGTCTTCCTTATAAGATCAGAAATTGAAAGC
chr6_GL864840_random:257915-257929
TTTAAATGTGACTTCTTAAAATTACTATAA257915AATGTTGTCAATGAATATTCTTCATTAAGTATTTGTATGCATATA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/sarHar1/TTCATTGACAACATT
lang : en | db : sarHar1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.077 | search_plus_done; http://172.18.8.77:28064/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.098 | 0.014 | search_minus_done; http://172.18.8.77:28064/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=38
0.101 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).