GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 08:58:11, GGGenome : Pig genome, SGSC Sscrofa11.1/susScr11 (Feb, 2017)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:102957308-102957322
GAAATAAAGGTCAGAGTTTAAGGAAATTGT102957308TTCATTGACAACATTAAATATTTACTAAATTTCAGCTTTTTCCCG
chr3:104974321-104974335
TCATGGAAATTATCTTTTCAAGTGATCAGA104974321TTCATTGACAACATTCACTTTGGAAGCCCATACCTCTCCCTTTCC
chr6:141559858-141559872
ATTAGGTAAAGCACTACTACGTAGGTCTGT141559858TTCATTGACAACATTCCAGATTCTGTTCTGCTGGGCTCTCACAAT
chr8:61336374-61336388
ACTTCCTGTCTGGATAGCTCCTTCTCTGGA61336374TTCATTGACAACATTTCCTTTTTTTGTTCACTAACCTTTCCACCA
chr2:108666820-108666834
GAGCAGTGGAAACGAGCTATGGATTATTTA108666820AATGTTGTCAATGAACTCAACTATATGACTCAGATCGTTATCATG
chr3:126559078-126559092
GTAGATGGGAACCTTAAAATAGCTATTACA126559078AATGTTGTCAATGAACTTGAGAATGTACAAGAAAACATAATGAGA
chr7:67055045-67055059
GGATAAGACCAAGCAGTATTACACTTCAAA67055045AATGTTGTCAATGAAACCATTAGCAAGTTTGTTGGAATATTCTTT
chr8:79893301-79893315
TTAATATTAATATTAAATGGATGCCCAGGG79893301AATGTTGTCAATGAAAATCTGTGTTTAAGAGATAATATATTCTAG
chr9:93348833-93348847
TAGGATATATTTTAGACTGAACATCTAGAA93348833AATGTTGTCAATGAAAAGCATTATGGCTTCAATAATTCTCCTGAT
chr11:28411330-28411344
GAAACAGAAACAATGAATAATTGGTTATGA28411330AATGTTGTCAATGAAAAGTACCTGTGATCACAGGCACAGGAAAAA
chr15:99540958-99540972
TGATAAGCAATGTTTATTTTTTGACTTCTG99540958AATGTTGTCAATGAATCGAAAGGGAAAGTTTAAAGATGTAAGACC
chr16:57368930-57368944
GAAGAGAGAGCCAGAAATAAACCTACACAT57368930AATGTTGTCAATGAATTTACAATAAAGAAGCCAAGATTATCCTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/susScr11/TTCATTGACAACATT
lang : en | db : susScr11 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.084 | 0.075 | search_plus_done; http://172.18.8.77:28768/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.092 | 0.008 | search_minus_done; http://172.18.8.77:28768/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.094 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).