GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:05:40, GGGenome : Rat genome, RGSC 5.0/rn5 (Mar, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:60985890-60985904
TTTTCAAAATCTTTTGCCTGTATAGACTTT60985890TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
chr2:77241554-77241568
CCTCTCCCATTTACATTTAGTTTTAAGTAA77241554TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
chr2:111132974-111132988
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT111132974TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
chr14:32165809-32165823
GAAGCTAATAGTGCAATCGCCATGGTCTCC32165809TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
chr18:24411369-24411383
ACATTCCTTACTCCTCTGACAGCAGTTTCT24411369TTCATTGACAACATTCAGGCTATCAGGCCTGATGTTGAGGTCCTT
chr2:84356655-84356669
ATTTGGAGTTGGGGTCTATAGCTGCCATAG84356655AATGTTGTCAATGAAACCTAATGGGTTGTTATGGTGAAAGTTCAG
chr2:258257794-258257808
ATACCAAGTAAAAAAACAAAAAAACAAAAA258257794AATGTTGTCAATGAAGGTGTGGAAGAAAATTTTCCAAACCTAGTG
chr3:36451894-36451908
CTACTTATTCATTCATGTATGTGGGTTTCA36451894AATGTTGTCAATGAACACTGCTGCTTCATCGAACACATGAAAAAT
chr4:231514733-231514747
CACACGAGTGTCTATCTCTCTATTTTCTTT231514733AATGTTGTCAATGAAAATACCATACCGTCTTGCTTAGCGCAGTTT
chr5:101992139-101992153
CATTGTCAACAGTTATACATTTGAAACTTT101992139AATGTTGTCAATGAAATAGATCTGTTCATCAAATAATCTGAAAAA
chr5:102066527-102066541
CATTGTCAACAGTTATACATTTGAAACTTT102066527AATGTTGTCAATGAAATAGATCTGTTCATCAAATAATCTGAAAAA
chr6:78769998-78770012
CCATAGATTAGTCATAGATAGCAGCTACTA78769998AATGTTGTCAATGAAGTTTCTACACAAATGGTAATTAGGCAATTT
chr7:112559627-112559641
TCTCTTATGTATCCATTGTCCAATTTCTAG112559627AATGTTGTCAATGAACTGTGTCTTTGAGGCAGTTTCTTTTTGAGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/rn5/TTCATTGACAACATT
lang : en | db : rn5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.77:28055/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.77:28055/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).